SGN Marker SSR290

SGN-M963

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: GAT   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: AATCAAGCCAACGCCTCTAA
Reverse primer: TCATCCTTCGCATACTTCCC
Predicted size: 209
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39209)
Chromosome
3
Position
171.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32132
Forward primer (5'-3')
AATCAAGCCAACGCCTCTAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCATCCTTCGCATACTTCCC
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Genomic location of SSR290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D963 marker 963
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)