SGN Marker U221657

SGN-M9631

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U221657
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40220)
Chromosome
8
Position
13.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35643
Forward primer (5'-3')
AGGTTTCAATGGTGGAGCAC
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 200+500
Solanum lycopersicum LA925: 700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGCTGCTCGTTTCAGACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Genomic location of U221657  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9631 marker 9631
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)