SGN Marker SSRB105694

SGN-M9638

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39309)
Chromosome
8
Position
87.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35680
Forward primer (5'-3')
AAAGCCAAAGTGGAAGAACTCAAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
CTCGTAAAACGTTCATCAATCTCGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum TA209: 220
Solanum pennellii TA56: 210
Approximate temperature
53°C
  
PCR data   Exp. ID 35680
Forward primer (5'-3')
AAAGCCAAAGTGGAAGAACTCAAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
CTCGTAAAACGTTCATCAATCTCGC
Enzymes
  
Accessions and product sizes
Solanum pennellii TA56: 210
Solanum lycopersicum TA209: 220
Approximate temperature
53°C
  
Genomic location of SSRB105694  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9638 marker 9638
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)