SGN Marker SSRB56555

SGN-M9644

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39312)
Chromosome
9
Position
50.40 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35683
Forward primer (5'-3')
TGCGGTAGACCCACTGAGTTATCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAAGGGAAGCATTTCTTCTCTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii TA56: 300
Solanum lycopersicum TA209: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 35683
Forward primer (5'-3')
TGCGGTAGACCCACTGAGTTATCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAAGGGAAGCATTTCTTCTCTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii TA56: 300
Solanum lycopersicum TA209: 280
Approximate temperature
55°C
  
Genomic location of SSRB56555  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9644 marker 9644
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)