SGN Marker SSRB102358

SGN-M9654

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39308)
Chromosome
10
Position
0.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35679
Forward primer (5'-3')
CTCGATCAATCTGTTCCCTTTTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCAAAATCCAGCATCATAGATCG
Enzymes
  
Accessions and product sizes
Solanum pennellii TA56: 280
Solanum lycopersicum TA209: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 35679
Forward primer (5'-3')
CTCGATCAATCTGTTCCCTTTTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCAAAATCCAGCATCATAGATCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum TA209: 300
Solanum pennellii TA56: 280
Approximate temperature
55°C
  
Genomic location of SSRB102358  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9654 marker 9654
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)