SGN Marker U241700

SGN-M9656

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U241700
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40247)
Chromosome
10
Position
41.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35655
Forward primer (5'-3')
GAGAATCTCGGGTTTTCGTTAG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 150+400
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAAGAAATCTTCCAACTCTTTCGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
55°C
  
Genomic location of U241700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9656 marker 9656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)