SGN Marker U241351

SGN-M9659

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U241351
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51060)
Chromosome
10
Position
62.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48996)
Chromosome
10
Position
61.65 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40246)
Chromosome
10
Position
65.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35654
Forward primer (5'-3')
CACCGTCAATCTCCATCCTC
Digested band sizes (using Tsp509I)
Solanum lycopersicum LA925: 150+250
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GATACCTGATGGCGGCTTAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
Genomic location of U241351  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9659 marker 9659
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)