SGN Marker SSR295

SGN-M968

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 55
Repeat motif: AAT   Repeat number: 9
Repeat motif:    Repeat number:
Forward primer: CTCCAGAAGGAACTCGATGC
Reverse primer: CAATTCCTTTCACCTGCCAC
Predicted size: 204
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40787)
Chromosome
2
Position
28.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008
Other PCR data 
PCR data   Exp. ID 31703
Forward primer (5'-3')
CTCCAGAAGGAACTCGATGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAATTCCTTTCACCTGCCAC
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Genomic location of SSR295  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D968 marker 968
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)