SGN Marker SSR301

SGN-M974

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 59 High: 50
Repeat motif: TTGGT   Repeat number: 2
Repeat motif: TA   Repeat number: 15
Repeat motif:    Repeat number:
Forward primer: TTTCCACCTCAAACCACTCC
Reverse primer: CCCTTTGACCTGTGCCA
Predicted size: 278
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39212)
Chromosome
10
Position
33.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 128
Forward primer (5'-3')
TTTCCACCTCAAACCACTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCCTTTGACCTGTGCCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 278+350
Solanum lycopersicum LA925: 278+278
Approximate temperature
55°C
  
Genomic location of SSR301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D974 marker 974
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)