SGN Marker SSR316

SGN-M989

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: AG   Repeat number: 6
Repeat motif: TTGCAG   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: CCACCGCAACAAACCTTATT
Reverse primer: GGGTGGTGAGAAGGATCTGA
Predicted size: 215
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43796)
Chromosome
1
Position
49.50 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44805
Forward primer (5'-3')
CCACCGCAACAAACCTTATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGGTGGTGAGAAGGATCTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43256)
Chromosome
1
Position
53.50 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44619
Forward primer (5'-3')
CCACCGCAACAAACCTTATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGGTGGTGAGAAGGATCTGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40792)
Chromosome
1
Position
66.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39218)
Chromosome
1
Position
46.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 8
Forward primer (5'-3')
CCACCGCAACAAACCTTATT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGGTGGTGAGAAGGATCTGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 217+217
Solanum pennellii LA716: 217+234
Approximate temperature
55°C
  
Genomic location of SSR316  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D989 marker 989
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)