SGN Marker TG342

SGN-M99

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG342 image not available
Forward sequence
NAGTCGACCTGCAGAGTGGCATATATTCACCCTATATCCTGGTAAACTAGTTTTTCAGATAACCATTCCACTCCCACTAAACTTAGACCT
TAAAACTGTATAACCTCGACTTGATTTTCGTAAAACAAATATTGAAGAGTTGTCTAGTTCAGTCGAGCTCGAATATATTATAGCTTAGTT
TAGCTCTACTCCTTATTATAGCAAGTTTGGTTGATCTCAGCTTGACATATTATTGCAATAAACTCTGTCTCTATTTCGATTTGGCTCGGC
TTGTTCAAC
Reverse sequence
AGAAGTGATACAATAGAAAATAAAATGCCAGCGGCATTATTACCTAGATCTCCCAAGAAGAAAACGACCTGTAGTGGATTCCTTTTGGGT
ATTAAATCCCCCACAGTACACAACGGATAAGCTAGGGGGCAAGGATGCAATATGCTGCCAAGTGAGCAAAGCACCTCGCCTGCGAGCACG
GGGACTGAACTCATCCATGGCTGTATTAACAATCTGAAATGAAAAACCTGGCGGCTCAACGCCTTTCAGCTGGAATGTGTAGAGTCTATG
TCAAGGGAGCAAAGCACTCAATAATCCATGCAGTAAGGGGTCATTTCGTTGCCGGCTAAAGTTATGCAGGTATTAGTTATTCAATAATCC
ATGAATATTTTTTTAACTTTCTCCCGGAGTTAAATTATAAAAGTCATGTTTGGCCATAAAATTCTAAAAGCCATATTTGGCCATATCACT
CACAAAAATTCCAAAACAATTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53276)
Chromosome
7
Position
62.50 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40861)
Chromosome
7
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8085)
Chromosome
7
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8086)
Chromosome
7
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG342 was used as an overgo probe on plate 8 [well H10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTGCAGAGTGGCATATATTCACCC
B sequence
AGTTTACCAGGATATAGGGTGAAT
AB sequence
CTGCAGAGTGGCATATATTCACCCTATATC
Marker sequence
NAGTCGACCTGCAGAGTGGCATATATTCACCCTATATCCTGGTAAACTAG
TTTTTCAGATAACCATTCCACTCCCACTAAACTTAGACCTTAAAACTGTA
TAACCTCGACTTGATTTTCGTAAAACAAATATTGAAGAGTTGTCTAGTTC
AGTCGAGCTCGAATATATTATAGCTTAGTTTAGCTCTACTCCTTATTATA
GCAAGTTTGGTTGATCTCAGCTTGACATATTATTGCAATAAACTCTGTCT
CTATTTCGATTTGGCTCGGCTTGTTCAAC
Genomic location of TG342  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D99 marker 99
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)