SGN Marker SSR326

SGN-M999

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 50
Repeat motif: AG   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: TTAGGCAGCTTACGACTGGA
Reverse primer: GAGCCAGAGGTCCTTCAGTG
Predicted size: 300
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39223)
Chromosome
6
Position
39.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31750
Forward primer (5'-3')
TTAGGCAGCTTACGACTGGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GAGCCAGAGGTCCTTCAGTG
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR326  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D999 marker 999
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)