EST details — SGN-E1225467

Search information 
Request: 1225467Match: SGN-E1225467
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C956772Clone name: SAL_UKA193xo01f1.ab1
nocartOrdering Not Available
Library Name: SAL_UKAOrganism: Nicotiana benthamiana

Tissue:
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1225467Length: 147 bp (162 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1225467 [] (trimmed) AGAACAAGCAAATGTAATCCTCTTTTTATTGGACTTTATAATTTCTGCTCTTTCAAGTAATGTAATGTATTTTCATGGACTTATAAGTGTTCCAT
GTCATTATTGTTGGTGATTGAATAAAACATTATACATGGCCCATGTTTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1225467] SGN-U511264 Nicotiana benthamiana Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T955857 [Download][View] Facility Assigned ID: SAL_UKA193xo01f1.ab1
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: