EST details — SGN-C109788

Search information 
Request: SGN-C109788Match: SGN-C109788
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C109788Clone name: cLPT-1-A21
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
This clone has been mapped as cLPT-1-A21.
Additional sequencing 
Clone: SGN-C109788 [cLPT-1-A21] Trace: SGN-T177733 EST: SGN-E366308 Direction: 3' Facility: TIGR
Clone: SGN-C194881 [TUS-71-P15] Trace: SGN-T348745 EST: SGN-E547870 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194881 [TUS-71-P15] Trace: SGN-T348746 EST: SGN-E547871 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366307Length: 526 bp (935 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E366307 [] (trimmed) TCATTTGGAAGTGTTTATTGCTTACCAGTTTCGGATTCACATAGCCAACTTCAACTTGTTTGGGATTGAGGCGTAGTTGTTGTACACCAGGGACA
GGAAATTGTGTTATGGGTTGGTTAGAAAAGATATTTGGAGGTTCCACACACAGGATCTCTGGTGGACAATACCATGGTGGGTATGAGGGTGCGCA
ATATCATGGGGGTTACGATGGAGGGCAATATCATTCGGGGCATGAAGGAGAACAATATCATGGAGGGTATAAGGACAGTACTACTTGGGACGGAC
CAACTACATCAGTGGATGAATTGTCAGATTTTGATAAAGAAGAAATTGATCGTGCCATTGCACTTTCTCTAGCAGAAGAGGATCAGAAAGGGAAA
AAAGTAATTGAGAGTGAACCCCATTTGGAGGAAGACGAGGCTCTCGCCAAGGCCCTTCAGGAAAGTTTGAATGTGGAGTCTTCTTCACCACCACC
ACCACCTCGATATGATTATGGAAGTCCCTTTCCCTCACTCTCATACTCGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366307] SGN-U584698 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177732 [Download] [View] Facility Assigned ID: TPTAA11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5