Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-C109861

Search information 
Request: SGN-C109861Match: SGN-C109861
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C109861Clone name: cLPT-1-E8
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
This clone has been mapped as cLPT-1-E8.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366237Length: 558 bp (984 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E366237 [] (trimmed) AAAATATGGTTTGTGTTGTTAACCACTATATTTGTGATCAATTTTAGGCCATTTTTAGTAATGGTAAAGGGTGAACCACAAGTGCCTTGTTTGTT
TATTTTTGGTGATTCTTTATTTGATAATGGAAATAACAATAATCTCATCACTACTGCAAAGGCTAATTATTCACCTTATGGAATTGATTTTCCTG
ATGGCCCTACTGGTAGATTCACCAATGGAAAAAACTCAGCAGATTTTCTTGCTGAATTATTGGGTTTTGATAAGTTTATTGAGCCATTTGCCACA
GTGAAGGGTGTGGATATATTTAGAGGTGTAAATTATGCCTCTGGTGCAGCTGGAATTCGTGACGAGTCAGGAATACATTTGGGAGATAGAATCAG
CTTGAACAGGCAATTGAGAAATCACAAGGTGACAATTTCCCACATGTCTATTCTACTTGGAAATAAAACCTTAACTATGGATTATCTAAGCAAAT
GTATATACATTGTTGGAATGGGCAACAATGACTACATCAATAACTACTTGATGCCTCAATTTTACCCATCAAGTCATTTATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366237] SGN-U579520 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177662 [Download] [View] Facility Assigned ID: TPTAB28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5