EST details — SGN-C110146

Search information 
Request: SGN-C110146Match: SGN-C110146
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C110146Clone name: cLPT-2-K10
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
This clone has been mapped as cLPT-2-K10.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365310Length: 607 bp (980 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365310 [] (trimmed) AGAACTAGTCTCGAGTTTTTTTTTTTTTATTCTTTTGGTTTGTTGTAGCTACTTGGTGTAGCAAGGAAAAGCGGCAAGATTGAGGTTCTTAGTCC
AGTCAATGGAGATGTTCGTGCATCCATTTCAATTGAAAGTCAAAATCATCCAGGATCGGCAGATAATTCTATTGTTGGTTTGCATTTATTCAAAG
GAGAAAGATTGGGATCATCATCAAGGTATTATCTTGTCCTGCTTTAGACAATACGAGCAGGAAGTGTCTAATTAATTACCTTAGTTACCTTATGG
AATAAGCAACTAGTAGAGGTAGACATATTGTTAGACTCTTCCTAGCAGAGTGCAAATGGTACAAAACTTTTCAAAATGTGGGTTAAAAGACTACT
TGTGTAGGTCGGGGTTGAGAATTGGGGGCCCGCACCCTATCCCATCAGCCTAAGCCTTGATTGCACCTCAGACATGCCTGATATAGATATACTAA
GAACTAGGACATGCATCTTTGACACATTAAGATGCCATGACTCGACTATCCAAGTCGGAAGTACGAACCACTCAATGAAGAATCTCAAGCCAAAT
TGGATCAGGTTCAGTGCTTGGATTGAAAAATGTTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365310] SGN-U596059 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177916 [Download] [View] Facility Assigned ID: TPTAF65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5