EST details — SGN-C110253

Search information 
Request: SGN-C110253Match: SGN-C110253
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C110253Clone name: cLPT-4-B13
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
This clone has been mapped as cLPT-4-B13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364753Length: 577 bp (924 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E364753 [] (trimmed) ATCAGTACAGTAAGGGAGTATTACAAGGAAAGTGGTGACATTGATGGGACTCTAAGGCAGTTACCTCGTTATCTGGTTGCTGAAAAGGCAATTTT
GCAGTGCCTGAAAAGATCTCCTGGAAACTATCTACAAGCTCTGAAGGCCATACCCAGGACTCTCCGAATGATGTATGTTCATAGCTATCAAAGTT
ATCTTTGGAACCATGCGGCAAGCATGAGAGTGCAAAAGCATGGGTTTGACCAAGTTGTGTTGGGAGATTTGGTGTATTCAAAAGAAGAGTATAAA
GTGAAAGAATCTTTTGTTGCTGAATGTGAAGACGTGAATGACAATAATATGGATGATTATAGCAATCTGGATGAGATCTCAGAGACTGATCTTCC
TGAAGAAAGAAATATACCAGTCAAGTTTATAAATGAAGAAGACCTTAAATCTGGTACATATACCATTGATGACGTACTTCTACCTTTGCCTGGGT
CTAGAGTTATTTATCCATCAAATGACATTGGTGAAGTTTACCGTGACTTGGCACAAAAGGATGGTATCAGCTTGACAGAGACTGCACATAAGATC
AAAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364753] SGN-U585361 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178154 [Download] [View] Facility Assigned ID: TPTAO07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5