EST details — SGN-C110291

Search information 
Request: SGN-C110291Match: SGN-C110291
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C110291Clone name: cLPT-4-D23
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
This clone has been mapped as cLPT-4-D23.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364858Length: 510 bp (937 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E364858 [] (trimmed) GCAAAACCTCATCTCCCCCCCCCCCCCTTCTCGTTACAAGATGTCTCTCTCAATGTGTTCACCTTTATACTCTCCATTTAAGCTTTCTTTCAAGG
AAGATAAAGGAAAGGTTAATTCTTGGGGATTGAGGCAAAGTTTAGGGAAGAAGAAATTGATGGTGGTGAGAGCTGGCCCAAAGAGAATAGCTTTT
GATAAAGAATGCAGAAGAGCTTTACTTTCTGGTATCAATAAGCTTGCTGATGCTGTTTCTGTCACTTTAGGACCTAGAGGCCGGAACGTAGTTCT
CTCTGAAGGTGGGGGGCTGAAAATAATTAATGATGGTGTTACCATAGCTCAAGCCATAGAACTTCCAGATACAATTGAAAATGCTGGAGCGACAC
TTATCCAGGAGGTTGCAACTAAGACCAACAGGTTAGCTGGTGACGGTACAACTACTGCAATTGTTTTGGCCCGTGAGATGATCAAAGCTGGGTTA
TTAGCTGTTGATTTTGGGGCTAACCCTGTATCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364858] SGN-U568698 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178259 [Download] [View] Facility Assigned ID: TPTAO24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5