EST details — SGN-C114765

Search information 
Request: SGN-C114765Match: SGN-C114765
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C114765Clone name: cTOA-24-N7
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOA-24-N7.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E315323Length: 590 bp (912 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E315323 [] (trimmed) TAATCTCTTCGGCACGAGGAAAGAAGGGGATGAGGAGGAGACTGGCTGCTGGATGAAGTTGAGGTTTATTAGTAGCTGTATTTCCTCAAGATCTA
AAGTTGATAACTCCATCAGTGGCATCAGCACTCGCTGTGAAAGTAAATCGACAAATGATACAAAAATATACCAGCCTGTTGCTCCAATTATCTCA
TCCACAACCACAAGTAATGCTGAAAGTAACTCTTCCACTTCCAAACTCGAAGAGGAACTTAAGGTTTTTTCGCAGCTTCGGAAGTTCACATTTAA
TGATTTGAAGTTGGCTACAAGAAACTTTAGACCAGAATCCCTTCTTGGTGAAGGGGGTTTTGGTTGTGTCTTTAAGGGTTGGATTGAAGAGAATG
GGACGGCACCTGTTAAACCAGGAACGGGGCTTACTGTTGCTGTGAAAACTCTAAATCATGATGGACTACAGGGTCACAAAGAATGGCTGGCGGAA
GTAAATTTCCTTGGCGATCTCATTCATCCCAATTTGGTTAAACTAATTGGGTACTGTATTGAAGATGATCAGAGGTTGCTGGTTTATGAATTTAT
GCCTCGAGGAAGCTTGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E315323] SGN-U584936 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T128287 [Download] [View] Facility Assigned ID: TFADQ76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5