Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C117028

Search information 
Request: SGN-C117028Match: SGN-C117028
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C117028Clone name: cTOA-4-C23
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOA-4-C23.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309957Length: 432 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E309957 [] (trimmed) GCTACAGATGGCGACAGAAAGCTTCAATGTTGATAACCTCATTGGCGAGGGATCATTTGGGCGTGTTTATAGGGCTCAGTTTGATGATGGAAAGG
TTCTTGCAGTCAAGAAAATCAACTCTTCTGCACTCCACAATCCTGAAGATTTTCTCGATATTGTTTCTGAGATATCACGGTTGAACCATCCAAAT
GTTACTGAGCTGGTTGGATATTGTTCAGAGCACGGGCAGCATCTGTTGGTTTATGAATTCCACAAAAATGGTTCTTTGCATGATTTCCTGCATCT
GTCACATGAGGAAAGCAAGCCTCTAACATGGAATAGCCGAGTTAAGATTGCACTAGGCACAGCAAGAGCACTAGAGTATCTGCACGAAGTTTGTT
CACCATCTTTGGTTCACAAGAATATCAAGTCTGCAAATATTGTACTTGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309957] SGN-U571992 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124430 [Download] [View] Facility Assigned ID: TFAAM24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5