EST details — SGN-C119534

Search information 
Request: SGN-C119534Match: SGN-C119534
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C119534Clone name: cTOB-1-K3
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182905 is on microarray TOM1: SGN-S1-1-2.1.5.5
This clone has been mapped as cTOB-1-K3.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E314509Length: 647 bp (872 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E314509 [] (trimmed) GAAAATTTCAGATTCCTTCACACATCCTCTCTCTCTGTCCCCAAAACTCAAACACTTTCAATTCACAATGGAATTACTTCTCTTCTTCTTCCTCA
CACCATTTCTCTTCTTTATTAACTGCTCTTCCATTACTCAAATTTCTTCACCATTGTTGATTTTACCCCTAAAAACTCAACAAATCTCATCTGGG
TTTTCATCTCCAAATAAACTCCCATTTACTCACAATGTTACTCTTACTGTTTCCCTTTCAGTTGGTACACCTCCACAGAATGTAACAATGGTGCT
CGATACTGCTAGTGAACTTTCATGGCTACATTCAAATTCAACCCGAATCAAACAACCCATTTTCAACCCCAACCGTTCACTCTCCTACAGACCCG
TTTCTTGCTCCGAACCCATTTGCACGACCCGAACCCAAGATTTTTCCATACCAGCTTCTTGTGATTCGAAGAATTTCTGTCATGCTGTGCTTTCT
TACGCAGATGCTTCGTCTTCAGAAGGGAATTTAGCTATGGATACGTTTACGATTGGCGGGTCGAATTTTACGGGTACGATATTCGGGTCAATGGA
TTCGGGTTTCAGTAGTGATTCGGATGAAGATGAAAAGACAACCGGGTTAATGGGTATGAACCCGGGATCTCTATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E314509] SGN-U582010 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130478 [Download] [View] Facility Assigned ID: TFBAA62THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5