EST details — SGN-C122715

Search information 
Request: SGN-C122715Match: SGN-C122715
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C122715Clone name: cTOB-5-H2
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOB-5-H2.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E316703Length: 421 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E316703 [] (trimmed) AATAATGAAATTTTATCTTTTTTTCACAATACAAGTTTATGGTACATGTGTTTTGTATGCATCAAATGATGAAAAAGAAAGAGAGTCCTGTGTTT
CTTCCTCATATGTCCTAATACAAAATCTATTTCCTAAATGGGAGATTATTGGGCTTATCTACTCCCTTAGATGTAGAGGAACAAGATGAGGACAT
GTTAGTCTTAGCAAATTCTTCTTTATCCTCCGTGAATGCTTTAGACAAAATTTCTTGAAGTTCCATGTACCTTTGCTTCTTCAGTTGACGCTCTT
CTACTGTATCATTCCCCATGTAAGCTATCTCAGACAAGTCATCAGCATCCATGATCTTATTTAGAACTTCTGAACAACGTGGAAAGAACCGTTTT
CCAAGTTCCACAGTTCTAGAGAGAGCCCTAAGCCGATTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E316703] SGN-U585807 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130584 [Download] [View] Facility Assigned ID: TFBAT37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0