Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C123055

Search information 
Request: SGN-C123055Match: SGN-C123055
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C123055Clone name: cTOB-9-B13
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOB-9-B13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E318604Length: 615 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E318604 [] (trimmed) GAAAGGGTTTACCAAACGCCGGCGAGGAAAGTGTATTTGCGGGTTCGAAAGCAATCGAAGAAGGTGAAGACTGTTTTAGGTGTTGTTACATGTCT
CACCTTACTCATTACTCTCAGATTACTCATCCATGACCACAATCACTTCTTTGTTTTAGCTGAGTTTGTTCATTTCATCGGTATCTTATGTTTGA
TTTACAAGTTGTCTACTCTCAAAACTTGCTCAGGCTTGTCATTGAAGAGTCAAGTGCTTACGGCGATCTTTCTGGCTGTAAGAGTATTTTGTAGT
TTCATCATGGAAGGAGATATACACACCATTCTAGATTTTGTTACACTTGCGGCAACATTGTGGGTAATATATATGATGAAGTTCAAGTTGAAGTC
GTCCTTCATGACAGATCTGGATAATATGCACTATTTGTATTTGATTGTGCCTTGTGTGGTTGCAGCCTTCTTAATCCATCCTGCTACGGCTCATA
ATTTCTTCTTCCGGATTCTTTGGGCTTTTTGTGTATACATGGAGTCTATCTCAGTGCTGCCTCAGCTTCGCTTGATGCAGAATGTCCAGATAATT
GAGCCGTTCACAGCTCATTATGTGTTTGCATTGGGTGTTGCAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E318604] SGN-U579793 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130974 [Download] [View] Facility Assigned ID: TFBBI07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5