EST details — SGN-C124056

Search information 
Request: SGN-C124056Match: SGN-C124056
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C124056Clone name: cTOC-14-L18
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as P63.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E326353Length: 522 bp (913 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E326353 [] (trimmed) GCCAAAATGGCCACACCTACTATTATTTTGAGCTTCTTGTTGATTTTTGGAGTGGCTATTTGTCAAAGTGAAGCTAGGGCATTTTTTGTGTTTGG
TGATTCACTTGTTGATAGTGGAAATAATAATTATTTGGCTACTACTGCAAGGGCTGATTCACCACCTTATGGTATTGATTATCCAACACGTAGAG
CAACTGGTCGTTTCTCTAATGGCTACAACATTCCTGACATTATCAGTCAACAAATTGGTTCATCAGAGTCACCACTACCTTACTTAGATCCAGCT
CTTACTGGACAAAGACTTCTTGTTGGTGCTAACTTTGCATCTGCTGGAATTGGAATACTAAATGACACTGGAATCCAATTTATTAATATTATTCG
AATGCCACAACAATTGGCTTATTTTAGACAATATCAAAGTAGAGTAAGTGGCCTTATTGGTGAAGCAAATACTCAAAGACTTGTAAATCAAGCTC
TTGTTCTTATGACTCTTGGAGGCAATGATTTTGTCAACAACTATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E326353] SGN-U585129 Tomato 200607 Build 2 97 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T138698 [Download] [View] Facility Assigned ID: TFCCD69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5