EST details — SGN-C129161

Search information 
Request: SGN-C129161Match: SGN-C129161
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C129161Clone name: cTOD-10-N13
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOD-10-N13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330966Length: 586 bp (968 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E330966 [] (trimmed) GAGTCTTTTGAGACCTAATCCTTTGTACTTGAATTTGGGGTGTGAAGATAGAGACTTGGGTCATTGATAAAAATGGCGGCAGGAACTGTTCCAGC
TTCATTTACAGGCTTGAAGAGCAATGAAAATGGTTTGGGGTTCGCAAAAAGTATGAACTTTATAAGAGTTTCCGACTTACAGAGGGTTAAGTTCC
GGCGAACAAAATTTTCTGTGATAAGAAATGCAAATCCTGGTCAAGAAACCATTGAACTTCAGCCTGCATCCGAAGGGAGTCCACTACTAGTTCCT
AGGCAAAAATATTGTGAATCCATATACAAAACTGTCAGAAGACAGACCTGCACTGTGATGGTTGGGAACGTGGCTCTTGGTAGCGAACATCCAAT
TAGAATTCAAACAATGACCACAACTGATACCAAAGATGTCGCTGCAACAGTAGAACAGGTGATGAAAATTGCTGATGCGGGAGCTGACATAGTTC
GGATTACAGTCCAAGGGAGGAAAGAAGCTGATGCATGTTTTGAAATTAAAAATACTCTGGTGCAAAAGAATTACAACATCCCTCTGGTGGCTGAC
ATTCATTTTGCTCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330966] SGN-U567167 Tomato 200607 Build 2 86 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T144316 [Download] [View] Facility Assigned ID: TFDBM79THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5