EST details — SGN-C139972

Search information 
Request: SGN-C139972Match: SGN-C139972
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C139972Clone name: cTOF-10-H7
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOF-10-H7.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E342043Length: 719 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E342043 [] (trimmed) GCTGATGCGGATATGGAGGATTATGGATTCGAGTATTCGGACGAGGAGCAGGAAGAACAAGATGTTGATATAGAGAATCAGTACTACAATTCTAA
AGGTATGGTCGAAACTGATCCCAAAGGAGCACTTGAGGGTTTTGCTGAAGTAGTACATATGGAGCCTGAGAAGGCAGAGTGGGGATTTAAAGCTT
TAAAGCAAACTGTTAAGCTTTACTATAAGCTAGGGAAGTTCAAGGAAATGATGGATTCTTATAGAGAAATGCTTACCTACATAAAATCAGCAGTG
ACACGGAACTATAGTGAGAAGTGTATAAATGGTATCATGGATTTTGTTTCTGGATCAGCTAGTCAGAACTTCAGCCTTTTGCAAGAGTTCTACCA
GACAACATTGAAAGCCCTCGAAGAGGCAAAGAATGAGAGGTTGTGGTTCAAGACAAATCTAAAGCTTTGCAAGATTTGGTTTGACATGGGGGAAT
ATGGACGAATGAGCAAGATTCTGAAAGAGCTCCACAAATCTTGTAAAAAAGAAGATGGCACTGATGATGAGAAGAAAGGGACACAATTGTTGGAG
GTATATGCAATTGAGATTCAAATGTATACAGAGACAAAAAACAACAAAAAACTGAAGGAACTGTACAACAAAGCACTTTCAGTCAAGTCGGCAAT
TCCTCATCCAAGAATAATGGGAATCATTCGTGAATGCGGAGGCAAAATGCATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E342043] SGN-U578817 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T155313 [Download] [View] Facility Assigned ID: TOFBM40THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5