Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C141698

Search information 
Request: SGN-C141698Match: SGN-C141698
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C141698Clone name: cTOF-17-H17
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOF-17-H17.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E343283Length: 655 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E343283 [] (trimmed) GGTTGAAATTAGGGTTAGGGTATCCATCCATCCATCAAGTAATCAATCATGCCGAAGAATAAGGGAAAGGGAGGAAAGAACAGGAAGAGAGGGAA
GAACGAAGCTGATGATGAAAAGAGAGAGCTTGTTTTTAAGGAAGATGGACAGGAATATGCTCAAGTTCTTCGTATGCTTGGAAATGGCCGATGTG
AAGCTATGTGTATTGATGGGACGAAACGTCTATGTCACATACGTGGTAAGATGCATAAGAAAGTTTGGATTGCCGCCGGTGATATCATCCTTGTC
GGACTCCGTGATTATCAGGATGACAAGGCTGATGTTATTCTGAAGTATATGCCAGATGAGGCAAGGTTGTTGAAGGCATACGGAGAGTTACCAGA
GAACACTAGGCTCAATGAGGGTATTGCTAATTTGGATGAAGAAGATGAGAATGCCGCTGATGATTACATTGAGTTTGAAGATGAAGACATTGACA
AAATCTAAAATTCCTTATCTAAACAGTGCTATCACTGGGGTTTCCTGTTGGCCTCACAATTATTTCCTTGGAGCTTGAGTTCAATACAAAAAGAA
AGAGAGACCTTATATGTACCATCTTAATATGATTGAACTTTGTGCACTAGTACTTCTGTATGAAGATTTATGNCTTTGGTGAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E343283] SGN-U575182 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T157148 [Download] [View] Facility Assigned ID: TOFCO45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0041 Quality Trim Threshold: 12.5