EST details — SGN-C14449

Search information 
Request: SGN-C14449Match: SGN-C14449
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14449Clone name: cLEC-7-P21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172997 is on microarray TOM1: SGN-S1-1-6.4.20.12
This clone has been mapped as cLEC-7-P21.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202047Length: 427 bp (822 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202047 [] (trimmed) CAGAATCAGATCAATGAGAAGATGATTGAACAGAAAGCACGAGTGGTGTCCCCTTACTTTTTGAACTCAAGGAATGGAGAAACTGAAGGTTGTGG
ACTGAAAGCTGGTAAAACTGTGTTCGAGCCTTGCTTATCTCAAAATCAGATCAATGAGAAGATGATTGAACAGAAAGCACGAGCGGTTTGCCCTT
ACTTTTTGAACTCAAGGAATGGAGAAACTGAAATGAAAAAAGGCAGGTCTGTAGAATGTGTGAAGAAAAGAAATGATAAAAAATTACGAACCAAA
GTTCGAGTGGTTTCCCCTTACTTTGCTAACTTAAAAGTGGGAGAAGAAATAAAGGTAGGTAAGGATAGTTCAAACGCTTCGAAGAACTGTCTCAA
TGGAAGAAAGGTTTCTCCCTACTTTCAAAATGCATATCGTGAAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202047] SGN-U564853 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25329 [Download] [View] Facility Assigned ID: TCABA95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5