EST details — SGN-C145492

Search information 
Request: SGN-C145492Match: SGN-C145492
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C145492Clone name: cTOF-29-N17
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOF-29-N17.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E348834Length: 771 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E348834 [] (trimmed) GGTCTTCATCAAGATAGAGCTTTTTTCGAACACTGAATCAGCCATGGCGGCTCTACAGTATTTGGAATCGCTACGCAATGATCATCCAGAGCTTT
CTGATTGGTACACGACGCTTGCAGATCTGTACCAACGCAAGCTCTGGCACCAGCTCTCTCTCAAGCTCGAACAGTTTGTCGCTCTCGCTGTTTTT
CAGGCTGGTGACACGTTGATACAGCTGTATCACAATTTCATCACTGATTTTGAGACAAAGATCAATCTTCTGAAGCTTGCACATTTCGCTGTAAT
CGTCTCTCGGCAATATTCGGAGAAAGATGCTGGAATAGGTTATCTGGAAGGAGTAGCAGAGAAGCTCCAAAATACTAAAGAGACACGGATAGAGG
AACCAATACTTTATATTAAGTTGCAGATTGCCCTATTTAAGCTAGAACAAGGGGATCAAAAAGAGTGCAAGAGGCTTTTAGAACAGGGGAATGCT
ACAATTGACAGCATGACCGATGTTGACCCCTCTGTTTATGCCAGTTACTATTTGGGTTTCATCTCAGTATCATAAAACGCGGCAGGAATTTGCAG
AGTTTTACAAAAGCGCTCTCCTCTATCTTGCATACGTTTTCAGTGGATTCTCTTTTCGGAGTCATTCAAGCTGGATTTTGGCGTTTGATTTGTCC
TTGTCTGCTTTACTGGGAGACAACGTATACAATTTGGGGGGAGTTGCTTGCTCATCCTATATTAAAGAGTTTGGTAGGGACACAAGTTGAATGGC
TATATCATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E348834] SGN-U583928 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T160402 [Download] [View] Facility Assigned ID: TOFEK81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5