EST details — SGN-C14950

Search information 
Request: SGN-C14950Match: SGN-C14950
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14950Clone name: cLEC-9-L9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEC-9-L9.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200695Length: 375 bp (463 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200695 [] (trimmed) CAGCAAAAGATTTTTGAACCGGCCCCACCACCAGTTGTGGAGGGTGGTCCTCCTGGCAGGAAGATTGTTGTGTCAACCAACATTGCAGAAACATC
TTTGACAATAGATGGCATTGTTTATGTCATAGATCCAGGATTTGCTAAGCAAAAGGTTTATAATCCAAGGGTGCGTGTGGAATCTTTGTTGGTGT
CTCCTATTTCAAAGGCCAGTGCACACCAGAGATCAGGACGTGCTGGAAGAACTCAGCCAGGAAAATGCTTTAGACTTTACACGGAGAAAAGTTTC
CATAATGACCTTCAACCTCAGACGTATCCAGAAATACTTCGGTCAAATTTGGCTAATACAGTTCTAACTTTGAAGAAGCTAGGTATTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200695] SGN-U578402 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24989 [Download] [View] Facility Assigned ID: TCABI65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5