Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C15356

Search information 
Request: SGN-C15356Match: SGN-C15356
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C15356Clone name: cLED-11-L12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175492 is on microarray TOM1: SGN-S1-1-7.4.13.19
This clone has been mapped as cLED-11-L12.
Additional sequencing 
Clone: SGN-C175492 [TUS-21-H18] Trace: SGN-T190725 EST: SGN-E378111 Direction: 3' Facility: INRA
Clone: SGN-C175492 [TUS-21-H18] Trace: SGN-T190726 EST: SGN-E378112 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235413Length: 599 bp (786 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E235413 [] (trimmed) TTATCAAAAGAAATAGACTTTTGTCCACATCAGAAGTTAAAACAAAATCCTACTGATACAAAGAGTACAGTCACTCAATAATTCTGCATAATTAG
TACGTAAAACTCCTAGAATTACAAGTAAATTCTGGATTAACAGTCATGATTTCAACAAACTAAACACTATGTTAATGCTCTATGACATCCAAGTT
TGAGGTTAGCCACAACACTGAAAATGAGTGAGGTTGTCATGTACTAGAATCTATCTCCGGCAGATTTCTCAACATCGTTGCAAAGTCAAAATATC
AGCTTTTTGCATAATCCTTTGTCAATTCTTTTATACCGACTTACAGGCTTCATAGGAGCAGCAGGGCAAGTATCAGAATCTCCACTAAGATGAGG
TGCAGAGGTAGGTGTCTTGTATCCATCAGAATCTGAAAGTGGAGTTGAGGCTTTTAAATGAAGATCCTCATTAATAACTTGTAGGAGAGAATTGT
ACAACAATTCAAATAACATCTCATCCTCAGACACCGTTCCCACATTTTCACTGAAATTCAAAGTCTCCTCAAAGTATAGCTGGCGTGTCACTTTG
GCTCGTGAATCTGTAAAATACTTTTTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235413] SGN-U563040 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51423 [Download] [View] Facility Assigned ID: TOVBR66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5