Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C16197

Search information 
Request: SGN-C16197Match: SGN-C16197
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C16197Clone name: cLED-15-I5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
This clone has been mapped as cLED-15-I5.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235623Length: 564 bp (654 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235623 [] (trimmed) CTGTTTCTTGCGAATCCAAGGAAAATCTTTCATTGACTTGCTGCTCAAACCTTCAGAAGATGATCTGAAGTTCTGGCCCCACAGTTTTGAGTTTC
GCCTCCGGATTACGCTGGCATCAGATGGAAGCTTGTCCTTGATATCTCGGATCAGAAATATTAATGGCAAACAGTTCAGCTTCTCATTTGCTTAT
CATACATACTTCTCTGTTTCCGACATAAGTGAAATAAGGATCGAAGGTTTAGAAACACTGGACTATCTGGACAACCTATGCCAGAAAGAACGCTT
TACTGAACAAGGAGATGCCATAACTTTTGAATCTGAGATGGACCGTGTCTACCTTAGTTCTCCTAATCGCATTGCTGTTCTTGATCATGAAAGGA
AACGGACATATCTGATAAGGAAGGAAGGACTGCCAGATACTGTGGTGTGGAATCCATGGGAGAAGAAAGCCAAAGCAATGGTGGATTTTGGTGAT
GATGAGTATAAACAGATGCTTTGTGTTGATGGAGCAGCAATAGAAAAACCCATCACCTTGAAGCCAGGAGAGGAATGGACCGGTCGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235623] SGN-U586358 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52196 [Download] [View] Facility Assigned ID: TOVCE51THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5