EST details — SGN-C16828

Search information 
Request: SGN-C16828Match: SGN-C16828
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C16828Clone name: cLED-17-L17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182462 is on microarray TOM1: SGN-S1-1-5.3.8.15
This clone has been mapped as P39.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238569Length: 633 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238569 [] (trimmed) GAAAAATTGGATCAACCATCACTTTAACTTCAGCTTGTAGAAAATAGCAACTACTCCAGATTAAGCAAGGAAATTTCCGAAAAAAGTCATCGATT
AAGGCAAATGAGGGGAGAAGAACTTCAAGGACTAAATATTGAAGAGTTGCAACAATTGGAGAGATCTCTTGAAACTGGATTGAGCCGCGTCATAG
AGAGAAAGGGTGATAAAATAATGAGAGAGATCAACCAACTCCAACAAAAGGGTATGCATCTAATGGAAGAAAATGAAAAATTAAGGCAACAGGTG
ATGGAGATATCTAATAATAATAATAATAATAATAATGGATATAGAGAGGCAGGAGTAGTAATATTTGAACCAGAAAATGGATTTAATAATAATAA
TAATGAAGATGGCCAATCATCTGAATCAGTAACAAATCCATGTAACTCAATTGATCCTCCTCCTCAAGATGATGATAGTTCTGATACTTCTCTCA
AATTGGGGCTACCTTACTCAGGCTGAAGAGATCAAAAGCAAGGTGTGGCTATTTTTGTATGTTATTAGAAGAAGGAGAAAAAAAAAAGTAACTAC
TAATTATTATAATTAATTAATGTCTGATTAATGTAAAAGCTAACCCCAAAAAATTCATAATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238569] SGN-U578103 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53011 [Download] [View] Facility Assigned ID: TOVCO69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5