EST details — SGN-C17247

Search information 
Request: SGN-C17247Match: SGN-C17247
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17247Clone name: cLED-19-B24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175867 is on microarray TOM1: SGN-S1-1-8.4.11.9
This clone has been mapped as cLED-19-B24.
Additional sequencing 
Clone: SGN-C175867 [TUS-22-H9] Trace: SGN-T180693 EST: SGN-E367944 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237721Length: 475 bp (852 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237721 [] (trimmed) TTGACTTTTACCTTTGCTGCCTCTTCTTGTTTTTTTCATCCATTTCTGCTTCTCCTTCTTCCTAGTCGATCTCTGCACGAATCCGAAAAAACCCC
TTTTTTTTGGAAATAGTTAGCTATGACTCTTGGTTCAGGAGGATCTAGTGTTGTGGTCCCTCGGAATTTCAGATTACTTGAGGAACTTGAACGTG
GTGAAAAGGGTATTGGAGATGGGACTGTAAGCTATGGGATGGATGATGGAGATGATATCTATATGCGTTCCTGGACTGGCACCATTATTGGTCCT
CACAATTCCGTTCATGAAGGTCGCATTTATCAGTTGAAGTTATTCTGTGATAAAGATTATCCAGAGAAGCCACCTAGTGTCCGCTTCCATTCTCG
AGTTAACATGACATGTGTCAACCATGAGACAGGAGTGGTGGAACCAAAAAGTTTGCTTTACTTGCAAATTGGGAGCGAGAGTTCACCATGGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237721] SGN-U577331 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53635 [Download] [View] Facility Assigned ID: TOVCX12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5