EST details — SGN-C17487

Search information 
Request: SGN-C17487Match: SGN-C17487
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17487Clone name: cLED-19-N16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184192 is on microarray TOM1: SGN-S1-1-3.3.16.1
This clone has been mapped as cLED-19-N16.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237589Length: 555 bp (854 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237589 [] (trimmed) CAATAACGATACAGTTTTTTAATTTATCATTTGCCAAAAACAAAGAATTACTAAACATAAATATCCATTTCCATTACACAATATACATATATATA
CACACACAAAGAAGAAAGAAGAAAGAAGAAATTAATATGGGTAGAGGAAGAGTACAATTGAAGAGAATTGAGAACAAAATTAATCGTCAAGTTAC
TTTTTCAAAGAGGCGATCTGGTTTGCTTAAAAAAGCTCATGAGATCTCTGTGCTTTGCGATGCTGAAGTTGGACTCATTGTTTTCTCAACTAAAG
GAAAACTCTTTGAGTATTCTACTGACTCTTGCATGGAAAGGATTCTTGAAAGGTATGAAAGGTACTCATATGCTGAAAGGCAGCTTAATGCTACT
GATATTATAACCCCGGGTAGCTGGACTTTGGAACATGCTAAGCTTAAGGCCAGACTTGAGGTTTTGCAAAGAAACCAAAAGCATTATGCAGGAGA
AGAGTTGGACACATTGAGTATGAAAGAGCTTCAGAATCTGGAACACCAGCTCGATTCTGCTCTTAAGCACATTCGATCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237589] SGN-U581535 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53503 [Download] [View] Facility Assigned ID: TOVCX80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5