EST details — SGN-C18270

Search information 
Request: SGN-C18270Match: SGN-C18270
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18270Clone name: cLED-22-K8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
This clone has been mapped as cLED-22-K8.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238110Length: 489 bp (748 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238110 [] (trimmed) CAGCCATGCCCTCCTCCATCTCATCATGGTCCTAAGCCACCAATTGTAAAACCTCCACATGTACCAAGACCTCCTATAGTGCATCCTCCTCCCAT
TGTCTCTCCACCTTCCACACCTAAACCACCAAAAACACCACCATTCACTCCAAAACCACCATCACCAATACCACCTATTGTTTCACCCCCTATTG
TTTATCCACCAATCACTCCAACACCACCTATTGTCCATCCACCAGTCACTCCAAAACCACCATCACCAACACCTCCTATTGTTTCACCCCCCATT
GTTTATCCACCAATCACTCCAACACCACCTGTTGTGTCACCTCCAATCATTCCAACACCACCTATTGTCTCTCCACCTTTTGTCCCCAATCCTCC
CGTGGTAATACCACCACCCTACGTGCCAAGTCCTCCGGTTGTTACTCCACCCATAGTTCCAACACCCCCTACACCATGCCCACCACCACCACCAC
CACCAGCAATAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238110] SGN-U579408 Tomato 200607 Build 2 115 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54176 [Download] [View] Facility Assigned ID: TOVDH64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.856 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5