EST details — SGN-C19940

Search information 
Request: SGN-C19940Match: SGN-C19940
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C19940Clone name: cLED-28-K23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
This clone has been mapped as cLED-28-K23.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241470Length: 549 bp (721 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E241470 [] (trimmed) CAGACATCTTGTTTAATGATGATGGGATATGGAGATCATGAGAACAACAACAACAACAATGGAAATGGTAATGGAAATGGAAATGGAAATGTAAC
AATTTGTGCTCCTCCAATGATGATAATGATGCCTCCTCCTCCTCCTTCTTTAACTAACAATAACAATGCATAAACAAGCATCAACAACATACTTT
TTCTTCCTTTCATGAACAACAACAACAATAATCCTCAAGAAGACAACAACTCTTCTTCTTCTTCCATCAAGACAAAGATTATGGCTCATCCTCAC
TACCATCGTCTCTTGACTGCTTATCTCAATTGTCAAAACATAGGAGCTCCGCCAGAAGTGGTGGTAAGGCTAGAGGAAATATGTGCCACGTCAGC
AACAATGGGCCGTATCAGTAGTAGTAGTGGTGCTGGAATCATTGGAGAAGATCCTGCACTAGATCAGGTCATGGAGGCTTATTGTGAGATGCTGA
CAAAATATGAACAAGAACTCTCAAAACCCTTCAAGGAAGCCATGGTTTTTCTTTCTAGAATTGAGTGTCAGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241470] SGN-U578026 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55948 [Download] [View] Facility Assigned ID: TOVEE72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0258 Quality Trim Threshold: 14.5