EST details — SGN-C20319

Search information 
Request: SGN-C20319Match: SGN-C20319
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20319Clone name: cLED-2-B4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182412 is on microarray TOM1: SGN-S1-1-7.1.8.15
This clone has been mapped as P26.
Additional sequencing 
Clone: SGN-C182412 [TUS-39-I2] Trace: SGN-T194876 EST: SGN-E393550 Direction: 3' Facility: INRA
Clone: SGN-C182412 [TUS-39-I2] Trace: SGN-T194876 EST: SGN-E398818 Direction: 3' Facility: INRA
Clone: SGN-C182412 [TUS-39-I2] Trace: SGN-T194877 EST: SGN-E393551 Direction: 3' Facility: INRA
Clone: SGN-C182412 [TUS-39-I2] Trace: SGN-T194878 EST: SGN-E393552 Direction: 5' Facility: INRA
Clone: SGN-C182412 [TUS-39-I2] Trace: SGN-T200432 EST: SGN-E399502 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E228256Length: 568 bp (974 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E228256 [] (trimmed) CAGATTAAAACCTCTTTCTCCTACCTGGGGAGATCCTTCCACTTCCCAATAACGATACAGTTTTTTAATTTATCATTTGCCAAAAACAAAGAATT
ACTAAACATAAATATCCATTTCCATTACACAATATACATATATATACACACACAAAGAAGAAAGAAGAAAGAAGAAATTAATATGGGTAGAGGAA
GAGTACAATTGAAGAGAATTGAGAACAAAATTAATCGTCAAGTTACTTTTTCAAAGAGGCGATCTGGTTTGCTTAAAAAAGCTCATGAGATCTCT
GTGCTTTGCGATGCTGAAGTTGGACTCATTGTTTTCTCAACTAAAGGAAAACTCTTTGAGTATTCTACTGACTCTTGCATGGAAAGGATTCTTGA
AAGGTATGAAAGGTACTCATATGCTGAAAGGCAGCTTAATGCTACTGATATTATAACCCCGGGTAGCTGGACTTTGGAACATGCTAAGCTTAAGG
CCAGACTTGAGGTTTTGCAAAGAAACCAAAAGCATTATGCAGGAGAAGAGTTGGACACATTGAGTATGAAAGAGCTTCAGAATCTGGAACACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E228256] SGN-U581535 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T48904 [Download] [View] Facility Assigned ID: TOVAH02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5