EST details — SGN-C22668

Search information 
Request: SGN-C22668Match: SGN-C22668
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C22668Clone name: cLED-38-P10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184183 is on microarray TOM1: SGN-S1-1-4.2.16.9
This clone has been mapped as cLED-38-P10.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244796Length: 450 bp (845 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244796 [] (trimmed) CAGAATTCACAGAAATTGTTGGCAATATGTCCAAACTTCACCACACAAATATAGCTGAAGTTATTGGTTATTGTTCAGAGCAGGGACATAATATG
TTAATCTTTGAGTATTTTAGAAATGGTTCACTTTATGAATTCCTTCATGTGTCAGATGACTTCAGCAAACCTCTTACATGGAACACAAGAGTCAG
AATTGCTCTAGGGGTCGCCCGTGCTCTTGAGTACCTGCATGAGGTTTGTTCTCCATCATGTCTCCACGGCAATATAAGAACTTCAAACATTGTGC
TCGATGCTGAATTGAATTCTCGTCTCTGTGAGTGTGGCATGGCAATGTTTCATCAGCGATCAAGCAAAAACTTGGATGCTGGATACACTGCTCCA
GAATGCACAAAACCTTCTGCATTTACTTTGAAGAGTGATGTTTATAGCTTCGGAGTTGTCATGTTGGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244796] SGN-U570917 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58408 [Download] [View] Facility Assigned ID: TOVFV89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5