EST details — SGN-C23160

Search information 
Request: SGN-C23160Match: SGN-C23160
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23160Clone name: cLED-4-K2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182560 is on microarray TOM1: SGN-S1-1-3.3.8.16
This clone has been mapped as P64.
Additional sequencing 
Clone: SGN-C182560 [TUS-39-O6] Trace: SGN-T195273 EST: SGN-E393947 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231487Length: 539 bp (1197 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231487 [] (trimmed) CAGGATCAATGCAGAAATCCAGGTCGCAGAGGTGTCGGGGTTCACAACAATGGGAGAACTGCTACAAACAACAGAAAGGCAACTCGAGGAAACAA
ATGCTGATGGTCTCACTTTGACTGACCTTATCCATTTGGAAAACGAACTTCAAACTGCTCTAATACATCTCAGAGCTAGAAAGACACATTTGATG
CTTGAATCTGCTAAGGTTCTTCATGAGAAGGAAAAACTGCTGCTAGAGGAAAAGAAACATCTGGAGGACAATATAGCTAGTATCAAGAAAAACAC
AAAAGTGAATGAAATGTCTGACCTTCCAGCACCCCACATGATTTGTGGACAACAAAAAGTTACCCTGAATTTCTTCTAGTGATTATCGTCGTATT
CGTCGAAAAGCCTTGCTTCTGCACCAGAGGAACCTGCAAAATTAGTTTCAATAAAACTAATAATTATTCATCCTTGTTCTTGTTTCTAATGGATG
ATGATTAAAGTTAACTTCTCTACTTTGACATATTTACTAGAGGGTGACTTATATGCCTATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231487] SGN-U578955 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49256 [Download] [View] Facility Assigned ID: TOVAN61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5