EST details — SGN-C23946

Search information 
Request: SGN-C23946Match: SGN-C23946
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23946Clone name: cLED-6-M17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175095 is on microarray TOM1: SGN-S1-1-4.4.14.20
This clone has been mapped as cLED-6-M17.
Additional sequencing 
Clone: SGN-C175095 [TUS-20-H5] Trace: SGN-T190053 EST: SGN-E377554 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233137Length: 425 bp (511 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233137 [] (trimmed) CTGCACTCCACCGATCATTCATCGCGATGTAAAATCAAGCAATATCTTGTTGGATTCTGATTTCACAGCCAAAATAGCTGATTTTGGGTTAGCCA
AGATTTTAGAGAAGAAAGGAGAGCTTAACACCATGTCTGCTGTTGCGGGTTCCTTTGGTTACATAGCACCAGAGTATGCTTATACAACGAAAGTG
AATGAGAAGATTGATATCTATAGCTTTGGGGTGGTGCTATTGGAGCTAGTGACAGGAAGACAACCAAATTTTGGGGATGAGCATACAAGCCTGGC
AGAATGGGCATGGAAGCAACACGGAGAAGGGAACACTGCCATCGATAATATGTTAGATACGGATATCAAAGAAACATGCTACTTGGAAGAAATGA
AGACAGTGTTCAGACTCGGGCTTATATGCACGAGCAACTTACCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233137] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50123 [Download] [View] Facility Assigned ID: TOVAU81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5