EST details — SGN-C2398

Search information 
Request: SGN-C2398Match: SGN-C2398
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C2398Clone name: cLEC-15-N20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C186077 is on microarray TOM1: SGN-S1-1-6.1.5.18
This clone has been mapped as cLEC-15-N20.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203503Length: 516 bp (840 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E203503 [] (trimmed) GTTGATTGGATATTGTTGGGAGGAGGAGCAGAGACTTCTCGTTTACGAGTATATGGCAAGGGGAAACCTCGAGGATCAACTATTTTCGAGATATT
CGAGTTGTTTGCCATGGTTGACCAGAATAAAAATTATGGTTGGTGCTGCAAAGGGACTGGCTTTCCTTCACGGAGAAGAAAAACCAGTAATCTAC
CGCGATTTTAAGGCTTCTAACATCCTCTTAGACTCGGATTACAGAGCCAAACTATCTGATTTTGGGCTAGCAAAGGATGGACCGGAAGGCGATGA
CACACATGTCTCAACTCGTGTGATGGGCACTCATGGTTATGCTGCTCCGGAGTACATCATGACTGGTCATTTGACAAGCAAGAGCGATGTGTACA
GCTTCGGAGTAGTTCTGTTAGAACTTATAACAGGACGACGAGCCATGGACAAGAAACGCCCCCTCAAAGAGCGAATCTTGGTGGATTGGGCAAGA
CCAATGCTAAGGGATCCACACAAGCTTGACAGAATAATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203503] SGN-U586320 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26604 [Download] [View] Facility Assigned ID: TCACH82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5