EST details — SGN-C24139

Search information 
Request: SGN-C24139Match: SGN-C24139
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24139Clone name: cLED-7-F15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175225 is on microarray TOM1: SGN-S1-1-2.1.13.5
This clone has been mapped as cLED-7-F15.
Additional sequencing 
Clone: SGN-C175225 [TUS-20-M15] Trace: SGN-T189794 EST: SGN-E377039 Direction: 3' Facility: INRA
Clone: SGN-C175225 [TUS-20-M15] Trace: SGN-T189795 EST: SGN-E377040 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231884Length: 515 bp (799 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231884 [] (trimmed) ATATTGATTCAAGAAGGTGTTTTTCGATGGGATCATTTGCTTATGTATTAGATGAGACCACAGCTTTACATGTTCCGGTAAGGAAATCACCGTCA
AAGAAGCAAGCAATCAAGAAGCTAAATCATAGACAAGCAATGTCTGAATGTGGTGGATGTGATTCAACAAGGGAGTTCAATGGATTTGAGGGATT
CAAATTTGCTGAAAAACCAATGAAAAGCAACAAGATTCTTGAACAAGGGAAATGCAAAAGAGAGAGCTTTTCAATATCCAAGATTTGGTTAAGGG
GAAAAAATGATGAGAGTACTAATCCAAGAAGGGCATCTTCATTCCGGTTCCCGGCCAACCACAACATTCCAGTCGCGGCACAGCCAGATGACTCT
GGCTCTGCCGCGACCAAGAATGGTTGTAGGAGGACAGTCTCAGAGATTAATCTTGGTACATGGGAAAACAATGTAGGATGTGATGAAGAAAATCA
ATGTTCCAATAGATTGGAATATCAACCAAAGACACCATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231884] SGN-U569164 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50393 [Download] [View] Facility Assigned ID: TOVBA32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5