EST details — SGN-C24473

Search information 
Request: SGN-C24473Match: SGN-C24473
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24473Clone name: cLED-8-G3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184255 is on microarray TOM1: SGN-S1-1-4.1.16.10
This clone has been mapped as cLED-8-G3.
Additional sequencing 
Clone: SGN-C184255 [TUS-44-E21] Trace: SGN-T191879 EST: SGN-E390553 Direction: 5' Facility: INRA
Clone: SGN-C184255 [TUS-44-E21] Trace: SGN-T197631 EST: SGN-E396305 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232829Length: 508 bp (1051 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232829 [] (trimmed) CTTATTTCCTCTTTCATCTACTTATGCATACTCATTTTCTTCACTCAATTTTTTAACTCTTTTTTTTTTCTTGGATAATGGCACTGACCCTTCTT
CATTCTCCCCTTAATTATCACATAAAAATTTTCCAAATTTCAAGATTCAATCAAAAAACCCCATTTCCCACTGCTTAAACAAACCCCACATAGTT
TTTTTGTTTTCACAATTCTTGCACCTTAGAGAACTTAAGGGTTGAAAGTAAAATAAATATGGAAGTTGGAAGGGTTATTAATGAAAAACTTTCTC
ATTGTCTCTGGATGTCCAATTCTTCCCCATCTTTTCATGGTTCTGTATCAATGGTTAATTTCGAAGATGTTGGTCGAGGAGAAGTGTCTAAAGAG
AGGTCATTTTTCCCAGGAATTGACAAAGAAGAAACTAGCAATGATGATTATGATAGCTGTTATCATCAGCCAGAGAAGAAGAGAAGACTTTTGCC
TAATCAAGTTCATTTTCTTGAGAAGAGTTTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232829] SGN-U578039 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50762 [Download] [View] Facility Assigned ID: TOVBC38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5