EST details — SGN-C24672

Search information 
Request: SGN-C24672Match: SGN-C24672
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24672Clone name: cLED-9-D21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
This clone has been mapped as cLED-9-D21.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233558Length: 579 bp (775 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233558 [] (trimmed) CAGCTTTTTCTTCATCTTTTTCTCAATATTTTCTTCCTTTTAACAACTATGGCAACAACAAGAAAAACCAAAAATTTCCTCTTCTTAGGTGGAAA
AGACAAAATTACCCCTCTTCCATCAAGCACAAATACCCTCCAATTTGAATTTGATGAAGCTGAAATGTGGAGTAATTCGGAAGAAATTAACAATG
TTGAACCAAAATTATCAATACCAAGTTCAAGATTATCGAAAAAAATGACGAAAAAGGGCGAAAGAAAGGCGATCAATGCGACGTCGTTGCCTGTG
AATATACCTGATTGGTCGAAAATATTAGGTGATGATGAGAAGGGTATTTTGGGAAAAAATATTATGTTCGATGATGATGGAGATTTTGATGATGA
AAATAGAATCCCACCACATGAATATTTAGCAAGAACAAGAGTTGCTTCATTTTCAGTACATGAAGGAATTGGAAGGACATTAAAAGGAAGAGATT
TAAGTATAGTTAGAAATGCTATTTGGAAAAAAATTGGTTTTGAAGATTAATATATTACGTTTCGTATCGTAGACTATCGATGCTGGAACGAAACG
AAACGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233558] SGN-U584700 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T51119 [Download] [View] Facility Assigned ID: TOVBI23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5