EST details — SGN-C29092

Search information 
Request: SGN-C29092Match: SGN-C29092
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C29092Clone name: cLEF-50-C16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEF-50-C16.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249195Length: 425 bp (967 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249195 [] (trimmed) GGGTTTTTTACTCAAGAATATGTGAAAATATATTAATAGAAAAAAAAATTAAACTTAGGCTCTGTAGGAGCTGGTTGATTCACTGACTTTGCATT
CATTCAACCTTAATAATTGCCCAAGACCAAAAATTTATCTAGCAAAAAAATAATTATCATCAATTGCTTTTTTAATTCTCCAAACAGCTAAAATA
GTTATAAAATCTTTTAATCTAACAAAACGATAGATAGTTCGATTGATGAACTCAGCCATCGAACCCGGTCTGGCTCCACACAGCATCTCGGACCC
GGCTCAAGTCCCGACCCTTTAACGTACGGCCCACACCTTCAAACACCGAGTGAGCGTTCGAGTTCCGGCTCCGAGCAATGTATTCATGCGGCGGA
ACCATCTCCGAGTCATGATCATCAACACCATCGTCCGAGTCATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249195] SGN-U579930 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62703 [Download] [View] Facility Assigned ID: TMGHP20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5