Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-C29370

Search information 
Request: SGN-C29370Match: SGN-C29370
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C29370Clone name: cLEF-51-A13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEF-51-A13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245832Length: 359 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E245832 [] (trimmed) GTTGGACCTTTGCCCTCACCTAGGGTTTTTCACTGAACCCATAAATTCAATTTTTTGTTTGTCTTCAAAATATCCAAAAAATAAATCTTGAATAT
ATTTTAATCTATAGTTATTTCTTGGTTTGCTGAAAATCTGTGTTATTTTATGTCTATATATATGTTTTAGGACTAAAAAAAGGATTCTGTTTCTG
CTGCTGAATCAAAAGAGAAGTTAATTGGAGATCTCATAAAGATGGAAAGCAAGAGGGATGGAAATGATGAATCCTTTGTTTTAATCAAGCAAGGA
GCTGAGGCTCGGGTTTTTGAGTCAACATTTGTGGGTAGAAGATGTATCATCAAGGAACGGTTTTCAAAGAAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245832] SGN-U571191 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62971 [Download] [View] Facility Assigned ID: TMGHS07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5