Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C29772

Search information 
Request: SGN-C29772Match: SGN-C29772
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C29772Clone name: cLEF-54-G22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEF-54-G22.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246041Length: 585 bp (960 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246041 [] (trimmed) CTCCGGCGAATTCATCCGCTTATCTGTCACCGTTCTCCGGTGAGGTTTACGAAGGTTTATAGCTCAAAGATGGGTGTTAAAGCAAGGAAGAAAGC
AATAACGAAGAAATTGAAAAAGGGAGCAAGCGATTTTTCTGCTTCTTCAGCTTCTAAAGAATGAAGCCCGTGAGTTTCTGCCATTAGAAGGTGGG
CCAGCGCAGAAGCTTCCAAAGACTGAGGTGAGGGAAAATAAAGCAACAGTGTTATATATCGGGAGAAATCCCGCATGGATTTTATGAAAATGAAA
TGGAAGGTTTTTTTAAGCAATTCGGTACCAATCAAGAGGCTTAGAATTGCAAGGAATAAAAAGACTGGAAAATCAAAGCATTTTGGCTTCATAGA
ATTTGAGTCTCCTGAGGTTGCAAAAGTTGTTGCTGAAACTATGCATAACTATCTCTTGTTTGAGCACTTACTGCAAGTTCAGCTTATTCCTCCTG
AACATGTACCATCCAAGATTGTGGAAAGGTGTGAACCGCTGGTACAAACCCTTGGATTGGGTTAAAATTGAAAGGGAGCGTCAAGACAAGGAAAG
AACACTGGATGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246041] SGN-U568906 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T63395 [Download] [View] Facility Assigned ID: TMGIF47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5