EST details — SGN-C30338

Search information 
Request: SGN-C30338Match: SGN-C30338
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C30338Clone name: cLEF-57-H10
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEF-57-H10.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249802Length: 591 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249802 [] (trimmed) TTTCTCTCTATCTGTTTTTTCTATGTCCTCCTGTAACCAGTCTCGAGCTCTGGGAATGATTCGCTCTCATGTTCTTTCCGTTCTTAGAAGTACTT
CTTCTCAGGTCCAGGCTGCAATACGAAGCAGTGGTGGTAGCAAAACATCTTTTGCCGAGGGTATAGAGTCATCTATAATATATGTACGCTTCAAG
GCTGCAGCAAATGAGCTTAAGCCTATCTTGGAGGAAATTGAAAGTAGAACACCTAGAAAAGAGTATATTCAACTTCTTGAAGAATGCCACAAACT
CTATTGTGAACAGCGCCTTTCCTTGATAAGAGGTATAGTGCAACAGCGGATCTCTGAATTTTCCAGGAAAGAAGCACTGTCGTCTTTAACTAGAT
CTGGATGTGCATATTTAATGCAGGTGTGTCAGCTAGAGCATCAACTTTTCAATCACTTCTTCCCATCATCTTCAGAGGACATTTCGAGTTTGACT
CCTCTTGTAGATCCTCTGTGTACTTTCCTCTATGATACATTGCGTCCTAAACTTATTCACGAAACAAATCTGGATGTTCTTTGTGAACTGGTTGA
TATCCTTAAAGTTGAAGTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249802] SGN-U584096 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T63931 [Download] [View] Facility Assigned ID: TMGIT41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5