EST details — SGN-C33924

Search information 
Request: SGN-C33924Match: SGN-C33924
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C33924Clone name: cLEG-29-A13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEG-29-A13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254483Length: 404 bp (1019 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E254483 [] (trimmed) TTTTTTTTTAATTTATCGTATTAAAGAATTTAGAGGGAATAATGGTCGGAGGGATGGCTAGGAGACCTCTAAGTCACCGGATTTTGACGTGTCAC
AACCGGGAAAGTGAATTTTCCGGCGACCATGCCATAAATATTTCTGATACTATTTTTAGTTTTCTTGATGAGGAGGGTTCGTCAACAGAAAGTGT
TACTGATGATGTTTATGTTGAAGATGAAAATGAAGAGAAAGAAAATGTTGAATATAATCAATTTTGGGAAACTCAACGTCAGCTTTTACAATCAG
TATTATGCCGGACGACAACATTAGAATCACAAATCCGAAGCATTACCAAACAAACCTTAAAAGAAGCATCAAAAAATTGCAGCTGTAAAATGGTG
AATAATATTAGTATTACTACTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254483] SGN-U575870 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68749 [Download] [View] Facility Assigned ID: TBFEI07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0253 Quality Trim Threshold: 14.5